6. Which of the following statements does NOT describe Darwin's theory of natural selection
A. Members of a population will complete
B. Members of population have heritable variations.
C. Populations tend to reproduce in small numbers.
D. Sa members of a population have adaptive traits.
Q: Complete the process of the blood flow through the heart by filling in the missing terms in the diag...
A: The heart is responsible for transporting blood throughout the body. The arteries are responsible fo...
Q: n what ways did you find the population simulator helpful/not helpful? Give two reasons.
A: Simulator is a device or program i.e designed to imitate the real sequences that are likely to occur...
Q: In sweet peas, the synthesis of purple anthocyanin pigment in the petals is controlled by two genes,...
A: In sweet peas, the synthesis of purple anthocyanin pigment in the petals is controlled by two genes,...
Q: 3. Cross a man with type B heterozygous blood with a woman with type O blood. What are the possible ...
A: ABO blood group is an example of multiple allelism. Co dominance are also seen in blood types when b...
Q: What is the difference between primary ecological succession and secondary ecological succession?
A: In this question we have to write the difference between primary ecological succession and secondary...
Q: Feral cats in Australia I read they are insaive species causing harm to wild life? What harm can the...
A: Feral cats are mainly untamed and unowned cats that mostly live in the wild and avoid socialization....
Q: Consider the following reaction. What is the consequence of the increase of cytosolic CAMP concentra...
A: During fight or flight response, heart rate and blood pressure increases. This means breathing occur...
Q: H* ions generated by reactions in the electron transport chain, as well as H* ions present in the ma...
A: The electron transport chain is a series of reaction in four protein complexes, taht creating an el...
Q: Select all the statements that are true regarding the drug treatments available for infectious disea...
A: *Infectious diseases are caused by organisms like bacteria and viruses and fungi and parasites. *Ma...
Q: 3 What is Polymerase Chained Reaction (PCR)? How does PCR work?
A: The world as a whole saw a surge of the disease COVID in the year 2020. For the detection of the vir...
Q: Find a protein of your choice, choose a part of it (containing at least 30 amino acid residues), fin...
A: Proteins are the working machinery of the cell. They are made up of amino acids that are linked to o...
Q: What can you observe when you view a Gram stained-mixture of bacterial specimen?
A: Gram-staining is a technique that helps us to differentiate between Gram-negative and Gram-positive ...
Q: (a) What is resource partitioning? (b) Fully describe an excellent example of resource partitioning.
A: A community consists of a population of different species.
Q: Question 3. An abnormally high levels intracellular tangles are observed to occur in the brains of p...
A: Q3.Tangles are seen in the cytoplasm of dead and dying nerve cells. They are composed of twisted st...
Q: describe why fehling's test is not an accurate for blood-glucose levels?
A: Fehling's solution is a substance reagent used to separate between water-solvent carb and ketone use...
Q: answer the question. The bombardier beetle is spraying a boiling hot liquid that contains irritating...
A: Introduction: Beetle is considered to be the gardener's friend and it is a fearsome predator as it c...
Q: Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical pro...
A: ANSWER;- Forward primer:Sequence = 5'-CT-GAATTC-ATGGCTAAAGGCGGAGCT-3'Length = 18 ntdGC content = 56...
Q: Describe the hair and give the components
A: Hair Thin elongated keratinized structures present over almost all of the body surface hair is forme...
Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser ...
A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and ...
Q: Compare the functions of statocytst, semicircular canals, uticle and saccule
A: Click to see the answer
Q: Why is PCR beneficial?
A: INTRODUCTION The Polymerase Chain Reaction (PCR) was formerly originated by American B...
Q: Describe the specimen and explain how the presence of fossil bacteria supports the idea that the Ear...
A: Answer : specimen is the term used for the sample of anything which is used for testing and which te...
Q: In Figure 6-14, write possible genotypes for each of thefour snakes illustrated.
A: Genotype is defined as the genetic makeup of an organism while phenotype is the physical manifestati...
Q: Which of the following is a mismatched? O a. Apicomplexa: Cryptosporidium O b. Ciliate: Giardia Ameb...
A: Click to see the answer
Q: Research has stated that there are factors that could affect the efficacy and duration of mosquito r...
A: There are many different types of mosquito repellants, but they all work to repel mosquitoes by mask...
Q: (b) (1) Explain the term reflex action. (ii) Expand the following biological abbreviations: (1) DNA ...
A: The human body is comprised of several body systems that work together in order to maintain day-day ...
Q: . Which of the following has a genotype with homozygous purple flower and heterozygous tall plant. C...
A: * Homozygous and heterozygous are used to describe the allele pairs. *Individuals that carry two ide...
Q: in your own words, describe the squash soup in terms of appearance, color, size, shape, texture (fi...
A: Squash soup is made from a wide varieties of squash which provides it a appetizing flavor. Along wit...
Q: You are performing a Gram stain on Gram-negative bacteria, and you stop after the addition of the al...
A: Gram negative bacteria: these bacteria are enclosed in hard capsule and don't retain the crystal vio...
Q: Why are the elements found in the I=P x A x T important in terms of them having an impact to our env...
A: Any organism cannot survive in isolation. It is surrounded by a number of biotic and abiotic factors...
Q: A woman will give birth to a quadruplets without knowing the gender. What is the probability of havi...
A: 1.Given, Quadruples are born.And the total possible outcomes are 2 power 4 i.e16. And t...
Q: Select all the characteristics that apply to BACTERIA but not Eukaryotes. □ lack membrane bound-org...
A: Introduction: Bacteria is a single celled prokaryotic organism. Their cell structure is simpler than...
Q: A glass spreader can be sterilized by dipping in 70 % ethanol and burning of excess False .a True .b
A: Introduction:- Spreaders, also known as cell spreaders, are laboratory instruments that allow sample...
Q: Which temperature is Taq polymerase's optimal temperature O 20 degrees C 72 degrees C 55 degrees C O...
A: Click to see the answer
Q: 1. A population graph with inverted pyramid means A. More children than adults B. More adults than c...
A: Population pyramid represents the population by gender and age at a given point in time. It shows to...
Q: 1. -penia - 2. -dilation - 6. -sclerosis - 3. -graphy - 4. -megaly - 5. -plasty - 7. -stenosis - 8. ...
A: Note - we are supposed to answer three subpart of a question. Please repost other questions separate...
Q: Unpacking Problem 411. What type of organism is E. coli?2. What does a culture of E. coli look like?...
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and s...
Q: What are cerebrovascular accidents?
A: Introduction In this question we will discuss about the cerebrovascular accident
Q: In humans, PKU (phenylketonuria) is a recessive disease caused by an enzyme inefficiency at step A i...
A: A recessive disease requires two copies of the abnormal allele to manifest, that is, individuals sho...
Q: 10. What is Relative Centrifugal Field (RCF, in g's) in a centrifuge with a rotor radius of 10 cm sp...
A:
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
SEE MORE QUESTIONS
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning